Skip to main content

Table 1 The reference collection of 14 gene pairs and 40 verified transcription-factor-binding sites used for testing

From: Identification of conserved regulatory elements by comparative genome analysis

Gene name Human sequence Rodent sequence Transcription factors Binding sequence Location MEDLINE ID [49]
Skeletal muscle actin AF182035* M12347 SP1 GCGGGGTGGCGCG -64/-51 11017083
    SRF ACCCAAATATGGCT -100/ -86 1922033
    TEF-1 GACATTCCTGCG -73/-51 11017083
Aldolase A α B crystallin X12447* J05517 MEF2 CCTAAATATAGGTC -125/-111 8413246
  M28638* U04320 SP1 AGGAGGAGGGGCA -343/-330 11017083
    SRF GCCCAAGATAGTTG -393/-379 11017083
Cardiac α myosin heavy chain Z20656 U71441 and M62404* MEF2 TTAAAAATAACTGA -327/-313 8366095
    TEF-1 AGGAGGAATGTGC -239/-226 7961957
    SRF CTCCAAATTTAGGC -62/-48 8782063
CEBPα U34070* M62362 AP2 α GGCCGGGGGCGGA -243/-232 9520389
    TBP TATAAAA -30/-24 96003748
Cell division cycle protein 2 L06298 and U69555 E2F TCTTTCGCGC -131/-119 94094909
  X66172*   cETS GGGAAG -109/-104 951721551
Cholesterol 7 α hydroxylase L13460 U01962* HNF3 β TCTGTTTGTTCT -175/-166 9799805
    cEBP ATGTTATGTCA -227/-217 28182075
Early growth response protein 1 AJ243425 M22326* SRF TGCTTCCCATATATGGCCATGT -88/-67 90097904
    SRF CCAGCGCCTTATATGGAGTGGC -358/-337 90097904
    SRF GAAACGCCATATAAGGAGCAGG -412/-391 90097904
Glucose-6-phosphatase AF051355* U57552 HNF3 β CCAAAGA -72/-66 9369482
    HNF3 β ACAAACG -91/-85 9369482
    HNF3 β GTTTTTGAG -82/-74 9369482
    HNF3 β TGTGTGC -180/-174 9369482
    HNF3 β TGTTTGC -139/-133 9369482
    HNF1 AGTTAATCATTGGCC -226/-212 9369482
Leptin U43589 U36238* SP1 GGGCGG -100/-95 9492033
    cEBP GTTGCGCAAG -58/-49 9492033
    TBP TATAAG -33/-28 9492033
Lipoprotein lipase M29549* M63335 NFY CAAT -65/-61 1918010
    cEBP TAGCCAAT -68/-61 1918010
    TBP TATAA -27/-23 1918010
Muscle creatine kinase M21487 AF188002 and M21390* SRF CCATGTAAGG -1236/-1227 93233638
    AP2 α GGCCTGGGGA -1220/-1211 93233638
    MEF2 TCTAAAAATAAC -1078/-1067 93233638
    MYF GGGCCAGCTGTCCC -253/-240 96347575
    MYF CCAACACCTGCTGC -1157/-1144 96347575
    P53 ATACAAGGCC -176/-167 96047120
    P53 ATACAAGGCC -158/-149 96047120
Rb susceptibility gene L11910* M86180 U49920 and S66110 SP1 GGGCGG -202/-188 1881452
Troponin I L21905*   MEF2 AGACTATAATAGCC -976/-962 9774679
    MYF TAAACAGGTGCAGC -879/-865 9774679
  1. GenBank accession numbers [41] are given for the human and rodent sequences. The transcription-factor-binding sequences refer to the human or rodent sequence(s) marked with an asterisk. 'Location' refers to the position of the TFBS relative to the transcription start site.